Category: Class 12 Biology

NCERT Solutions For Class 12 Biology Human Health and Disease

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 8 Human Health and Disease:

Section Name	Topic Name
8	Human Health and Disease
8.1	Common Diseases in Humans
8.2	Immunity
8.3	AIDS
8.4	Cancer
8.5	Drugs and Alcohol Abuse
8.6	Summary

QUESTIONS FROM TEXTBOOK SOLVED

1.What are the various public health measures, which you would suggest as safeguard against infectious diseases?
Ans. The various public health measures against infectious diseases includes the following –
1.Education – People should be educated about the infectious diseases so that they may protect themselves against the infections.
2.A people suffering from any infections should be isolated to avoid its transmission to any other person.
3.Vaccination – People should get vaccination to avoid infection. Vaccination is available against cholera, typhoid, TB etc.
4.Sanitation – Sanitary surroundings can prevent spread of diseases. Public hygiene includes – suitable disposal of waste & human excreta; periodic cleaning and disinfection of water sources; observing normal practices of hygiene in public catering. Personal hygiene includes keeping the body clean, intake of clean drinking water, vegetables, fruits etc.
5.Eradication of vectors – The breeding places of vectors should be destroyed & adult vectors killed by appropriate methods.

2.In which way has the study of biology helped us to control infectious diseases?
Ans.The science that makes a study of diseases is called pathology, though in a broad sense it includes diagnostic, prophylactic and curative measures too. Pathology is a study of diseases of all kinds though we will confine ourselves to the diseases caused by a pathogenic organism, the reaction of the host as shown in the form of symptoms, the diagnosis made through a study of their symptoms, etiology of the pathogenic organism and finally steps undertaken to cure the host of its diseases, by eradicating and if it is not possible, by controlling the pathogen. In this way the study of biology helped us to control infectious diseases.

3. Hovy does the transmission of each of the following diseases take place?
(a)Amoebiasis (b) Malaria
(c)Ascariasis (d) Pneumonia
Ans. (a) Amoebiasis – It is usually contracted by ingesting water or food contaminated by amoebic cysts.
(b)Malaria – It is transmitted from one person to another by the female Anopheles mosquito. The mosquito picks up the parasite along with the blood when it bites an infected person. When this mosquito bites an other healthy person, the parasites migrate into his blood with the saliva, which the mosquito injects before sucking up blood to prevent its clotting.
(c)Ascariasis – Transmitted through water, vegetables, fruits etc. contaminated with the eggs of the parasites.
(d)Pneumonia – Spreads by cough & sneezes, by sharing drinking glass & eating utensils with an infected person.

4.What measures would you take to prevent water borne diseases?
Ans: Water borne diseases can be prevented by –
(i) Oral dehydration
(ii) Health education
(iii) Control of reservoirs
(iv) Immunization
(v) General hygiene, pure water

5. Discuss with your teacher what does ‘a suitable gene’ means, in the context of DNA vaccines.
Ans: A DNA vaccine consists of a suitable gene encoding an antigenic protein, inserted into a plasmid, and then incorporated into the cells in a target animal. The plasmid vaccine carrying the DNA (gene) enters the nucleus of target cells and produces RNA, and in turn the specific antigenic protein, because these proteins are recognized as foreign. When they are processed by the host cells and displayed on their surface, the immune system is alerted, which then triggers a range of immune responses.

6. Name the primary and secondary lymphoid organs.
Ans: Primary lymphoid organs – Bone marrow and thymils.
Secondary lymhoid organs – Spleen, lymph nodes, tonsils.

7. The following are some well-known abbreviations, which have been used in this chapter. Expand each one to its fall form:
(a) MALT
(b) CMI
(c) AIDS
(d)NACO
(e) HIV
Ans: (a) MALT – Mucosal Associated Lymphoid Tissue
(b) CMI-Cell-Mediated Immunity
(c) AIDS – Acquired Immuno Deficiency syndrome
(d) NACO – National AIDS Control Organization
(e) HIV – Human Immuno Deficiency Virus

8. Differentiate the following and give examples of each
(a) Innate and acquired immunity
(b) Active and passive immunity
Ans: (a) Innate & acquired immunity
Innate immunity, also called inherent, natural, non specific immunity, comprises all those defence elements with which an individual is bom & which are always available to protect a living body. It acts on many organisms and does not show specificity, e.g. Lysozyme present in secretions such as tears, catalyzes the hydrolysis of molecules in the cell walls of bacteria & interferon induces antiviral state in non infected cells. They act as physiological barriers & check the growth of many pathogenic micro-organisms. Acquired immunity, also called adaptive or specific immunity, is the immunity obtained either from the development of antibodies in .response to exposure to an antigen, as from vaccination or an attack of an infectious diseases or from the transmission of antibodies as from mother to foetus through the placenta.

(b) Active & passive immunity
Active immunity is acquired by catching & surviving an infectious disease or by vaccination with a weakened form of the diseases which makes the body to form antibodies. Whereas passive immunity is conferred by transfer of immune products like antibodies etc. from other individual

9. Draw a well-labelled diagram of an antibody
Ans:

10. What are the various routes by which trans-mission of human immunodeficiency virus takes place?
Ans: Various routes by which transmission of human immunodeficiency virus takes place are
(i) Illicit sexual contact.
(ii) Sexual contact with multiple partners.
(iii) Transfusion of the blood of infected person.
(iv) Intravenous drug users that shares needles are at high risk of contracting AIDS.

11. What is the mechanism by which the AIDS virus causes deficiency of immune system of the infected person?
Ans: HIV critically injures the immune system by infecting and eventually killing T-cells. Once the virus has infected a T cell, HIV copies its RNA into double stranded DNA copy by mearis of viral enzyme reverse transcriptase. This process is called reverse transcriptase because it violates the usual way in which genetic information is transcribed. Because reverse transcriptase lacks thg proofreading function that most DNA synthesizing enzymes have, many mutations arises as the virus replicates, further hindering the ability of the immune system to combat the virus. These mutations allow the virus to evolve rapidly resulting in the lost of vital cells. As a result of progressive destruction of its T-cells, the body is easily ravaged by a number of common infectious agents. In many instances, these infections would have caused little injury if there functional T-cells clones available.
Death ultimately results from the relentless attack of opportunistic pathogens or from the body’s inability to fight off malignancies.
virus. These mutations allow the virus to evolve rapidly resulting in the lost of vital cells. As a result of progressive destruction of its T-cells, the body is easily ravaged by a number of common infectious agents. In many instances, these infections would have caused little injury if there functional T-cells clones available.
Death ultimately results from the relentless attack of opportunistic pathogens or from the body’s inability to fight off malignancies.

12. How is a cancerous cell different from a normal cell?
Ans: Cancer is a disease characterized by the excessive and abnormal growth of certain cells. In a healthy individual, the growth of cells is balanced by the rate of cell loss. Thus, when one attains adult age, the size and cellular contents of various body organs remain constant. The balance between the growth of the cells and the rate of cell class may be dislocated by certain chemicals, physical stresses and viral agents. As a result, the normal growth of the cells may be transformed into cancerous one. Cancerous cells acquire the ability to invade new sites, a phenomenon called metastasis. They exhibit a number of alterations on cell surface, in the cytoplasm, and in their genes. These features are used for the identification of cancers.

13. Explain what is meant by metastasis.
Ans: Metastasis is the phenomenon in which cancer cells due to unregulated proliferation spread to distant sites through body fluids to develop secondary tumors. Only malignant tumors show the property of metastasis.

14. List the harmful effects caused by alcohol/drug abuse.
Ans: Harmful effects caused by alcohol abuse are –
(i) Alcohol generates more energy mostly in the form of heat, but at the same time, it dilates the blood vessels. Consequently the ‘heat generated is rapidly lost. Due to constant dilation, the arterial walls soon become brittle & rigid. Such a change in the property of blood vessels & deposition of alcoholic fat affect the working of heart.
(ii) Alcoholism leads to gastric ulcers & gastritis.
(iii) In chronic alcoholism, the axon of the nerve inflame thus causing neuritis.
(iv) Permanent damage to liver cells occur due to deposition of fats. The liver dries up & harden (cirrhosis).
Harmful effects caused by drug abuse are –
(i) Excessive doses of drugs may lead to coma & death due to respiratory failure, heart failure & cerebral haemorrhage.
(ii) Lack of interest in personal hygiene, withdrawal, isolation, depression, fatigue aggressive & rebellious behaviour etc.
(iii) Acquire serious infections like AIDS & hepatitis B, who take drugs intravenously.
(iv) The adverse effects of drugs are manifested in the form of reckless behaviour, vandalism & violence.

15. Do you think that friends can influence one to take alcohol/drugs? If yes, how may one protect himself/herself from such an influence?
Ans: Yes, friends can influence one to take drugs. Following measures can be taken:
(i) Avoiding undue peer pressure.
(ii) Not taking undue pressure of failures beyond its threshold.
(iii) Getting counselling from some counsellor
(iv) Seeking help from parents and peers
(v) Seeking medical help

16. Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit? Discuss it with your teacher.
Ans: Psychological & physiological dependence of an individual to the intake of certain kinds of drugs and alcohol is called addiction. Once a person start taking alcohol & drugs, it is very difficult to get rid this habit because addiction drive people to take them even when these are not needed or even when their use becomes self destructive. With repeated use of drugs, the tolerance level of the receptors present in the body increases, consequently, the receptors responds only to higher doses of drugs or alcohgl leading to greater intake & addiction. Thus, the addiction potential of drugs & alcohol, pull the user into a vicious circle leading to their regular use (abuse) from which he/she may not able to get out.

18. In your view what motivates youngsters to take to alcohol or drugs and how can this be avoided?
Ans: Human have probably been using mind – affecting drugs since time immemorial. The root cause of addiction of man to drugs, smoking and drinking has been due to his inability to make mental adjustments with stresses and strains, drudgery and extreme misery in daily life. As a temporary measure, to combat these adverse situations and to have a certain degree of mental relaxation, humans have been making an extensive use of stimulants, depressants and hallucinogens. Stimulants generally speed up body process, and depressants slow them. Hallucinogens can alter a person’s thoughts, feelings, and perception.
In preventing drug abuse, the role of parents
could be:
(i) Communicate openly with the children, listen to their problems patiently and teach them how to handle the problems.
(ii) Take interest in children’s activities and their friends circle.
(iii) Set an example for children by not taking drugs or alcohol.
(iv) Keep track of prescribed drugs in home.
(v) Learn as much as possible about drugs.

More Resources for CBSE Class 12:

NCERT SolutionsMathsPhysicsChemistryBiologyScience

NCERT Solutions For Class 12 Biology Molecular Basis of Inheritance

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance:

Section Name	Topic Name
6	Molecular Basis of Inheritance
6.1	The DNA
6.2	The Search for Genetic Material
6.3	RNA World
6.4	Replication
6.5	Transcription
6.6	Genetic Code
6.7	Translation
6.8	Regulation of Gene Expression
6.9	Human Genome Project
6.10	DNA Fingerprinting
6.11	Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Ans: Nitrogenous Bases – Adenine, Uracil and Cytosine, Thymine; Nucleosides – Cytidine, guanosine.

2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Ans: In a DNA molecule, the number of cytosine molecule is equal to guanine molecules & the number of adenine molecules are equal to thymine molecules. As a result, if a double stranded DNA has 20% of cytosine, it has 20% of guanine. The remaining 60% includes both adenine & thymine which are in equal amounts. So, the percentage of adenine is 30%.

3. If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
Write down the sequence of complementary strand in 5′ —> 3′ direction.
Ans: If the sequence of one strand of DNA is written as follows:
5′ – ATGCATGCATGCATGCATGCATGCATGC – 3′
The sequence of the complementary strand in 5′ —> 3′ direction will be:
5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′

4. If the sequence of the coding strand in a transcription unit is written as follows: 5-ATGCATGCATGCATGCATGCA TGCATGC-3′
Write down the sequence of mRNA.
Ans: mRNA: 5′ -A U G CAU G CAU G C AU G CA UGCAUGCAUGC-3′.

5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain
Ans: The antiparallel, double-stranded nature of the DNA molecule led Watson and Crick to hypothesise semi-conservative mode of DNA replication. They suggested that the two strands of DNA molecule uncoil and separate, and each strand serves as a template for the synthesis of a new (complementary) strand alongside it. The template and its complement, then form a new DNA double strand, identical to the original DNA molecule. The sequence of bases which should be present in the new strands can be easily predicted because these would be complementary to the bases present in the old strands. A will pair with T, T with A, C with G, and G with C. Thus, two daughter DNA molecules identical to the parent molecule are formed and each daughter DNA molecule consists of one old (parent) strand and one new strand. Since only one parent strand is conserved in each daughter molecule, this mode of replication is said to be semiconservative. Meselson and Stahl and Joseph Taylor, later proved it by experiments.

6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Ans: (i) DNA dependent DNA polymerase – synthesis.
(ii) DNA dependent RNA polymerase – synthesis.
(iii) RNA dependent DNA polymerase – Retroviral nucleic acid.
(iv) RNA dependent RNA polymerase – cDNA synthesis.

7. How did Hershey and Chase differentiate between DNA and protein in their experiment white proving that DNA is the genetic material?
Ans: Alfred Hershey and Martha Chase (1952) worked with viruses that infect bacteria called bacteriophages. In 1952, they chose a bacteriophage known as T2 for their experimental material.
They grew some viruses on a medium that contained radioactive phosphorus (p32) and some others on medium that contained radioactive sulphur (s35). Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protem does not. Similarly, viruses grown on radioactive sulphur contained radioactive protein but not radio’active DNA because DNA does not contain sulphur.
Radioactive phages were allowed to attach to E. coli bacteria. Then, as the infection proceeded, the viral coats were removed from the bacteria by agitating them in a blender. The virus particles were separated from the bacteria by spinning them in a centrifuge. ,
Bacteria which was infected with viruses that had radioactive DNA were radioactive, indicating that DNA was the material that passed from the virus to the bacteria. Bacteria that were infected with viruses that had radioactive proteins were not radioactive. This indicates that proteins did not enter the bacteria from the viruses. DNA is therefore the genetic material that is passed from virus to bacteria.

8. Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNAand tRNA
(c) Template strand and Coding strand
Ans: (a) The main differences between repetitive DNA and satellite DNA are as following:
(b) The main difference between mRNA and tRNA are as following:
(c) The main difference between template strand and coding strand are as follows :

9. List two essential roles of ribosome during translation.
Ans: Two essential roles of ribiosomes during translation are ;o
(i) they provide surface for binding of mRNA in the groove of smaller sub unit of ribosome.
(ii) As larger sub unit of ribosome has peptidy transferase on its ‘P’ site, therefore, it helps in joining amino acids by forming peptide bonds. .

10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then why does lac operon shut down some time after addition of lactose in the medium?
Ans: Lac operon is switched on, on adding lactose in medium, as lactose acts as inducer and makes repressor inactive by binding with it. When the lac operon system is switched on, β-galactosidase is formed, which converts lactose into glucose and galactose. As soon as all the lactose is consumed, repressor again becomes active and causes the system to switch off (shut down).

11. Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) tRNA
(c) Exons
Ans: Promoter: It is one of the three components of a transcription unit that takes part in transcription. It is located at the start 5′ end and provides site for attachment of transcription factors (TATA Box) and RNA polymerase. tRNA: It takes part in the transfer of activated amino acids from cellular pool to ribosome for their taking part in protein formation.
Exons: In eukarytoes, DNA is mosaic of exons and introns. Exons are coding sequences of DNA which are transcribed and translated both.

12. Why is the Human genome project called a mega project?
Ans: Human genome project is called a mega project because
(i) it required bioinformatics data basing and other high speed computational devices for analysis, storage and retrieval of information.
(ii) it generated lot of information in the form of sequence annotation.
(iii) it was carried out in number of labs and coordinated on extensive scale.

13. What is DNA fingerprinting? Mention its application.
Ans: DNA fingerprinting or DNA typing is a technique of determining nucleotide sequences of certain areas (VNTRs) of DNA which are unique to each individual. Each person has a unique DNA fingerprint. Unlike a conventional fingerprint that occurs only on the fingertips and can be altered by surgery, a DNA fingerprint is the same for every cell, tissue and organ of a person. It cannot be changed by any known treatment. Applications of DNA fingerprinting are as follows:

• Paternity disputes can be solved by DNA fingerprinting.
• DNA fingerprinting technique is being used to identify genes connected with hereditary diseases.
• It is useful in detection of crime and legal pursuits.
• It can identify racial groups, their origin, historical migrations and invasions.

14. Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
Ans: Transcription : It is DNA directed synthesis of RNA in which the RNA is transcribed on 3*—>5’ template strand of DNA in 5’—>3’ direction. Polymorphism: Variation at genetic level arisen due,to mutation, is called polymorphism. Such variations are unique at particular site of DNA, forming satellite DNA. The polymorphism in DNA sequences is the basis of genetic mapping and DNA finger printing.
Translation : Protein synthesis from mRNA, tRNA, rRNA.
Bioinformatics : Computational method of handling and analyzing biological databases.

More Resources for CBSE Class 12:

NCERT SolutionsMathsPhysicsChemistryBiologyScience

NCERT Solutions For Class 12 Biology Principles of Inheritance and Variation

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 5 Principles of Inheritance and Variation:

Section Name	Topic Name
5	PRINCIPLES OF INHERITANCE AND VARIATION
5.1	Mendel’s Laws of Inheritance
5.2	Inheritance of One Gene
5.3	Inheritance of Two Genes
5.4	Sex Determination
5.5	Mutation
5.6	Genetic Disorders
5.7	MUTATION
5.8	GENETIC DISORDERS
5.9	Summary

QUESTIONS FROM TEXTBOOK SOLVED

1.Mention the advantages of selecting pea plant for experiment by Mendel
Ans: Mendel select garden pea (Pisum Sativum) for the following reasons.
(i) It is an annual plant with short life span and gives results within 3 months.
(ii) The plant is grown easily and does not require after care except at the time of pollination.
(iii) F1 hybrids are fertile.
(iv) Seven pairs of contrasting characters easily detectable.
(v) True breeding self pollination.

2. Differentiate between the following –
(a) Dominance and Recessive
(b) Homozygous and Heterozygous
(c) Monohybrid and Dihybrid.
Ans: (a)The difference between dominance and recessive me:

(b) Differences between homozygous and heterozygous individuals :

(c) In breeding experiments when a cross is made between the individuals considering their same single character, it is called mono¬hybrid cross, while a cross is done consid¬ering two characters at fee same time is called dihybrid cross (Yellow Round * Green Wrinkled).

3. A diploid organism is heterozygous for 4 loci, how many types of gametes can be produced?
Ans: For a diploid organism, which is heterozygous for 4 loci, then 2⁴ i.e. 2 x 2 x 2 x 2 = 16 types of gametes can be produced if the genes are not linked because for each heterozygous pair of genes there are two possibilities. So, for 4 pair the number of combination will be 16 gametes.

4. Explain the Law of Dominance using a monohybrid cross.
Ans: When two different factors (genes) or a pair of contrasting forms of a character are present in an organism, only one expresses itself in the F, generation and is termed as dominant while the other remains unexpressed and called recessive factors (gene).
A tall (TT) true breeding plant is crossed with a dwarf (tt) plant. The character of height is represented by‘T’ for tall‘t’ for dwarf are the alternate form as character of height. The Fj hybrid ‘Tt’ is Tall, showing that tall is dominant over dwarf while dwarf remains unexpressed in F, offspring due to phenomenon of dominance by tall factor or gene.In this Tt heterozygous has tall phenotype showing T is dominant over t allele.

5. Define and design a test-cross.
Ans: When an individual is crossed with the homozygous recessive parent. It is called test cross.

Test cross helps in establishing hetero/ homozygosity of dominant trait.

6. Using a Punnett Square, workout the distribution of phenotypic features in the first filial generation after a cross between a homozygous female and a heterozygous male for single locus.
Ans:

Phenotype: All tall
Genotype ratio : TT: Tt 2:2 or 1:1

7. When a cross is made between tall plant with yellow seeds (TtYy) and tall plant with green seed (Ttyy), what proportions of phenotype in the offspring could be expected to be
(a)tali and green.
(b)dwarf and green.
Ans: A cross between tall plant with yellow seeds (TtYy) & tall plant with green seed (Ttyy) is given below.

8. Two heterozygous parents are crossed. If the two loci are linked what would be the distribution of phenotypic features in F1 generation for a dihybrid cross?
Ans: Consider 2 characters Blue (B), long (L) seeds of a plant – both characters linked.

9. Briefly mention the contribution of T.H. Morgan in genetics.
Ans: Thomas Hunt Morgan (1866-1945), an American geneticist and Nobel Prize winner of 1933, is considered as “Father of experimental genetics” for his work on and discovery of linkage, crossing over, sex linkage, criss cross inheritance, linkage maps, mutability of genes, etc. He is called fly man of genetics because of selecting fruit fly (Drosophila melanogaster) as research, material in experimental genetics. It was largely due to his book, “The Theory of Gene”, that genetics was accepted as a distinct branch of biology. In 1910, he discovered linkage and distinguished linked and unlinked genes. Morgan and Castle (1911) proposed “Chromosome Theory of Linkage” showing that genes are located on the chromosomes and arranged in linear order. Morgan and Sturtevant (1911) found that frequency of crossing over (recombination) between two linked genes is directly proportional to the distance between the two. 1% recombination is considered to be equal to 1 centi Morgan (cM) or 1 map unit. He worked on sex linked inheritance and reported a white eyed male Drosophila in a population of red eyed and proved that gene of eye colour is located on X-chromosome. The male passed its genes on X-chromosomes to the daughter while the son gets genes on X-chromosome from the female (mother): It is called criss-cross inheritance.

10. What is pedigree analysis? Suggest how such an analysis, can be useful.
Ans: Pedigree analysis is study of pedigree for the transmission of particular trait and finding the possibility of absence or presence of that trait in homozygous or heterozygous state in a particular individual. Pedigree analysis helps-
(i) in analysis of transmission of character in family over generation.
(ii) in genetic counselling of disease like haemophilia.
(iii) to identify whether a particular genetic disease is due to recessive gene or a dominant gene.
(iv) to identify the possible origin of the defective gene in the family or in a population.

11. How is sex determined in human beings?
Ans: Sex determination refers to the mechanisms employed by organisms to produce offsprings that are of two different sexes. The sex of an individual is determined by the genetic information present in the individual’s sex chromosomes. Sex determination in human is done by XY type chromosome. In humans, females have two XX chromosomes and males have two different chromosomes (XY).

12. A child has blood group O. If the father has blood group A and mother of blood group B, work out the genotypes of the parents and the possible genotypes of the other off springs.
Ans:

13. Explain the following terms with example
(a) Co-dominance
(b) Incomplete dominance
Ans: (a) Codominance : Codominance is the phenomenon of two contrasting alleles of the same gene lacking dominant recessive ratio and expressing themselves simultaneously when present together. E.g. ABO blood group system – Human blood group AB is formed when alleles of blood groups A and B are present together (IAIB). Such RBCs carry both antigen A & B showing that both die alleles are expressing their effect phenotypically & codominant.
(b) Incomplete dominance : Incomplete dominance may be defined as the partial /expression of both alleles in a heterozygote so that the phenotype is intermediate between those of two homozygotes. In this none of the allele is completely dominant, e.g., Pink colour flower in dog flower. In Mirabilis jalapa & Snapdragon or dog flowers, there are two types of flower colour in pure state-red & white. When the two types of plant are crossed, the hybrid or plants of Fj generation have pink flowers. The pink colour apparently appears either due to mixing of red & white colours (incomplete dominance) or expression of a single gene for pigmented flower which produces only pink colour.

14. What is point mutation? Give one example.
Ans: Mutations arising due to change in single base pair of DNA is called point mutation. Eg., sickle cell anaemia, haemophilia.

15. Who had proposed the chromosomal theory of the inheritance?
Ans: Chromosomal theory of inheritance was proposed by Sutton and Boveri independently in 1902. The two workers found a close similarity between the transmission of Mendelian hereditary factors (genes) and behaviour of chromosomes during gamete formation and fertilisation. They proposed that chromosomes were the carriers of the Mendelian factors. It is the chromosome and not genes which segregate and assort independently during meiosis and recombine at the time of fertilisation in the zygote. Chromosomal theory of inheritance was expanded by Morgan, Sturtevant and Bridges.

16. Mention any two autosomal genetic disorders with their symptoms.
Ans: Sickle cell anaemia : Haemoglobin has less 02 transport, sickle shaped RBCs etc.
Phenylketonuria : Mental retardation (due to accumulation of phenylalanine in brain), hypopigmentation of skin & hair, eczema etc.

More Resources for CBSE Class 12:

NCERT SolutionsMathsPhysicsChemistryBiologyScience

NCERT Solutions For Class 12 Biology Sexual Reproduction in Flowering Plants

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 2 Sexual Reproduction in Flowering Plants:

Section Name	Topic Name
2	Sexual Reproduction in Flowering Plants
2.1	Flower – A Fascinating Organ of Angiosperms
2.2	Pre-fertilisation : Structures and Events
2.3	Double Fertilisation
2.4	Post-fertilisation: Structures and Events
2.5	Apomixis and Polyembryony
2.6	Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. Name the parts of anangiosperm flower in which development of male and female gametophytes take place.
Ans: Development of male gametophyte (micro- gametogenesis) occurs in pollen sac of anther up to 2 – celled stage. The female gametophyte develops (megagametogenesis) in the nucellus of ovule.

2. Differentiate between microsporogenesis and megasporogenesis. Which type of cell division occurs during these events? Name the structures formed at the end of these two events?
Ans: Differences between microsporogenesis and megasporogenesis are as follows –

Each microspore mother cell and megaspore mother cell contain two sets of chromosomes and are therefore diploid. The diploid megaspore mother cell and microspore mother cell enlarges and undergo meiosis to produce, four haploid cells called megaspores and microspores respectively.The chromosome number is reduced by half and therefore megaspores and microspores are haploid.
Microsporogenesis and megasporogenesis give rise to pollen grains and embryo sac respectively. Pollen grain is the male gametophyte and embryo sac represents the female gametophyte.

3. Arrange the following terms in the correct development sequence: Pollen grain, sporogenous tissue, microspore tetrad, pollen mother cell, male gametes.
Ans: The correct developmental sequence for the formation of male gametes is :
Sporogenous tissue —» Pollen mother cell —» Microspore tetrad —» Pollen grain —» Male gametes.

4. With a neat, labelled diagram, describe the parts of a typical angiosperm ovule.
Ans:

A typical angiospermic ovule is a small structure which is formed in the ovary. Ovule first develops as a projection on the placenta and composed of multilayered cellular tissue called the nucellus. The hypodermal cell of die nucellus enlarges and transformed into megaspore mother cell. This cell undergoes meiosis to produce four haploid cells only one of which develops & forms embryo sac (female gametophyte). An ovule may be surrounded by one or two protective layers called integuments, leaving a small opening at one end termed as micropyle which acts as passage for the entry of the pollen tube into the ovule. Thus, a typical ovule consists of a fully developed embryo sac with the nucellus and integuments.

5. What is meant by monosporic development of female gametophyte?
Ans: In majority of flowering plants one of the megaspores is functional while the other three degenerate. Only the functional megaspore develops into the female gametophyte or embryo sac. This method of development of embryo sac from a single megaspore is called monosporic development.

6. With a neat diagram explain the 7-celled, 8- nucleate nature of the female gametophyte.
Ans:

Embryo sac (or female gametophyte) is formed by three successive mitotic divisions that take place in the nucleus of megaspore.
The nucleus of the functional megaspore divides meiotically to form two nuclei which move to the opposite poles, forming the 2-nucleate embryo sac. Two more sequential mitotic nuclear divisions result in the formation of the 4-nucleate and later the 8-nucleate stages of the embryo sac. After the 8-nucleate stage, cell walls are laid down leading to the organisation of the typical female gametophyte or embryo sac. Six of the eight nuclei are grouped together at micropylar and chalazal end and form the egg apparatus and antipodals respectively. The large central cell left over with two polar nuclei. Thus, a typical female gametophyte consists of 7 cells with 8 nucleus.

7. What are chasmogamous flowers? Can cross-pollination occur in deistogamous flowers? Give reasons for your answer
Ans: Chasmogamous flowers are those flowers which are open with exposed anther and stigma.

Cleistogamous flowers are those flowers which do not open at all. In these flowers, the anthers and stigma lie close to each other, when anthers dehisce in the flower buds, the pollen grains come in the contact with stigma to effect pollination. So these flowers are invariably self-pollinated as the flowers remain closed and there is no chance of cross pollen landing on the stigma. Pollination and seed setting are assured even in the absence of pollinators

8. Mention two strategies evolved to prevent self-pollination in flowers.
Ans: Continued self-pollination decreases the vigour and vitality of a particular race. Thus, flowering plants have developed many devices to discourage self-pollination and to encourage cross-pollination.
Dichogamy and self-sterility are.two most common devices that ensure cross-pollination. Dichogamy – Maturation of anther and stigma at different times in a bisexual flower prevent self-pollination.
Self-sterility (or self-incompatibility) – Due to the presence of self-sterile gene in some flowers, pollen grains do not germinate on the stigma of that flowers. e.g.,- tobacco, potato.

9. What is self-incompatiblility? Why does self-pollination not lead to seed formation in self-incompatible species?
Ans: If a pistil carrying functional female gametes fails to set seeds following pollination with viable and fertile pollen, capable of bringing about fertilisation in another pistil, the two are said to be incompatible, and the phenomenon is known as sexual incompatibility. Sexual incompatibility may be interspecific (between individuals of different species) or intraspecific (between individuals of the same species). The latter is also called self-incompatibility. Self-incompatibility is a gene-physiological process. Incompatibility reactions are controlled by a single gene, called S-gene, which has several alleles. Pollen grains that possess the S-allele common to any one of the two alleles present in the cells of the pistil, will not be functional on that particular pistil. However, every pollen grain having no common S alleles with pistil would be functional on the pistil of a that plant. As self pollens are unable to fertilise the egg to form pmbryo, hence seeds are not formed in self-incompatible species.

10. What is bagging technique? How is it useful in a plant breeding programme?
Ans: It is the covering of emasculated flowers (removal of anthers in bud condition from a bisexual flower by a bag of butter paper or polythene in their bud condition i.e., before anthesis) to prevent contamination of its stigmas with unwanted pollens. When the stigmas of emasculated flowers mature the bags are removed, stigmas are dusted with pollen grains of desired male . plants by means of a presterilized brush and flowers are rebagged till fruit develop. This technique is mainly used in artificial hybridization. Plant breeders often use this technique to prevent the contamination of stigma of the flowers from unwanted pollen grains.

11. What b triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.
Ans: Fusion of second male gamete with die two polar nuclei located in the central cell to form the triploid primary endosperm nucleus (PEN) is called triple fusion or vegetative fertilization. This process takes place in the embryo sac. After reaching the ovary, pollen tube enters into the embryo sac from the micropylar end. After penetration, the tip of the pollen tube ruptures releasing the two male gametes. The one male gamete fuses with the egg to form the diploid zygote. This process is called syngamy and the other male gamete fuses with the two polar nuclei to form the triploid primary endosperm & this process is known as triple fusion. These two events of fertilization constitute the process of double fertilization.

12.Why do you think the zygote is dormant for sometime in a fertiUsed ovule?
Ans: The zygote after a period of rest develops into embryo. Most zygotes remain dormant till certain amount of endosperm forms. They do so, to provide assured nutrition to the developing embryo.

13. Differentiate between:
(a)hy pocotyl and epicotyl;
(b)coleoptile and coleorrhiza;
(c)integument and testa;
(d)perisperm and pericarp.
Ans:

14. Why is apple called a false fruit? Which Part(s) of the flower forms the fruit?
Ans: Botanically ripened ovary is called a true fruit. The fruits in which thalamus and other floral parts develop along with the ovary are called false fruits. For example – apple, strawberry, cashew etc. In apple the main edible portion of the fruit is the fleshy thalamus. Ovary forms the fruit after fertilization or without fertilization in parthenocarpic fruits.

15. What is meant by emasculation? When and why does a plant breeder employ this technique?
Ans: Removal of stamens or anthers of a bisexual flower without affecting the female reproductive organs is called emasculation. This technique is used in artificial hybridisation. In such crossing experiments it is important to make sure that only the desired pollen grains are used for pollination and the stigma is protected from contamination from unwanted pollens. This is achieved by emasculation and bagging technique. This technique is used to obtain desired variety of seeds.

16. If one can induce parthenocarpy through the application of growth substances, which fruits would you select to induce parthenocarpy and why?
Ans: Parthenocarpic fruits are seedless. They develop from ovary without fertilization. Banana, grapes, oranges, Pineapple, Guava, Watermelon, lemon are selected because these seedless of units are of high economic importance. The fruits in which seeds or seed part form edible portion (e.g.,Pomegranate) are not selected to induce parthenocarpy.

17. Explain the role of tapetum in the formation of pollen grain wall.
Ans: Tapetum is the innermost wall layer of anther. The cells of this layer have large nuclei and dense cytoplasm. This layer is of great physiological importance as most of the food material from outside passes through this layer. At maturity, these cells degenerate and provide nourishment to developing microspores or pollens inside. Tapetum is the layer, which secretes both enzymes and substances of hormonal nature.
The main function of tapetum is to provide nutrition to pollens but it also secretes some substances of utmost importance like :

• Qallase enzyme : Tapetum secretes callase enzyme which dissolves callose substances by which four pollens of a pollen tetrad are united, hence separating microspores or pollens of a tetrad.
• Ubisch bodies : These bodies of lipid nature are also secreted by tapetum. Ubisch bodies get covered with sporopollenin and thus increase thickness of exine (i.e., outer layer of pollen wall). Ubisch bodies are spheroidal and have diameter of only few microns. These are produced only by glandular tapetum (not by amoeboid tapetum).
• Pollen kit substances : Tapetum also secretes pollen kit, outer most oily, thick, viscous, sticky, electron dense homogeneous coating of pollen grains of many entomophilous plants.

18. What is apomixis and what is its importance?
Ans: Apomixis is a mode of asexual reproduction that produces seeds without fertilization, e.g.- some species of Asteraceae and Grasses. This method is important in hybrid seed industry. Hybrids are extensively cultivated for increasing productivity. But the main drawback is that the hybrid seeds are to be produce every year because the seeds of the hybrid plants da not maintain hybrid characters for longer period due to segregation of characters. This can be avoided if apomixis can be introduced in hybrid seeds. For this reason scientists are trying hard to identify genes for apomixis.

More Resources for CBSE Class 12:

NCERT SolutionsMathsPhysicsChemistryBiologyScience

NCERT Solutions For Class 12 Biology Environmental Issues

Topics and Subtopics in NCERT Solutions for Class 12 Biology Chapter 16 Environmental Issues:

Section Name	Topic Name
16	Environmental Issues
16.1	Air Pollution and Its Control
16.2	Water Pollution and Its Control
16.3	Solid Wastes
16.4	Agro-chemicals and their Effects
16.5	Radioactive Wastes
16.6	Greenhouse Effect and Global Warming
16.7	Ozone Depletion in the Stratosphere
16.8	Degradation by Improper Resource Utilisation and Maintenance
16.9	Deforestation
16.10	Summary

QUESTIONS FROM TEXTBOOK SOLVED

1. What are the various constituents of domestic sewage? Discuss the effects of sewage discharge on a river.
Ans:  Domestic sewage contains four kind of impurities:
(i) Suspended solids: They are soil particles such as sand and silt.
(ii) Colloidal particles: They are inorganic and organic materials such as faecal matter, bacteria, paper and cloth.
(iii) Dissolved solids : They are nitrates, phosphates, ammonia, sodium, calcium and other nutrients.
(iv) Pathogens : Domestic sewage has pathogens of various diseases such as typhoid, cholera, dysentery, diarrhoea, etc. Effect of sewage discharge on river are:
(i) Eutrophication.
(ii) Growth of pathogenic bacteria.
(iii) Ageing of river where slit and decaying matters start accumulating and filling river.
(iv) Increase in BOD.
(v) Destruction of flora and fauna of that river.

2. List all the wastes that you generate at home, school or during your trips to other places. Could you very easily reduce the generation of these wastes? Which would be difficult or rather impossible to reduce?
Ans: Waste materials generated at home : paper, disposable cups, cloth, plates, spoons, plastic envelopes, discarded food etc.

Waste materials generated at school are : paper, chalks, plastic envelopes etc.

Wastes materials generated during trips are : paper, disposable cups, plates, spoons, plastic envelopes, discarded food etc.

No, we cannot reduce the generation of these wastes easily, but few can be reduced. The wastes belong to two categories : biodegradable and non-biodegradable. It is difficult or rather impossible to reduce discarded food like peel of potato, peel of banana etc. We can do one important thing i.e., to reduce wastage of food.

3. Discuss the causes and effects of global warming. What measures need to be taken to control global warming?
Ans: Increase in atmospheric concentration of green house gases has resulted in rise of atmospheric temperature by 0.6°C (global wanning) in die 20th century. This has been confirmed by intergovernmental panel on climatic change (IPCC) in its reports of 1991 and 1992. This predictable change in near future may affect climate, sea level, range of species distribution, food production as well as fisheries resources in the oceans.
Causes of global warming:
(i) Increase in concentration of greenhouse gases.
(ii) Increase of automobile and use of fossil fuel.
(iii) Deforestation and change in land use.
(iv) CFC and aerosol emission from refrigerator and aeroplane.
(v) Increased particulate matter in lower atmosphere.
Effects of global warming:
(i) CO₂ fertilisation effect.
(ii )Many species of plants, being sensitive to temperature will die with sudden rise in temperature and their place will be taken over by scrub vegetation.
(iii) Loss of biodiversity.
(iv) Rise in sea level.
(v) Possibilities of drought and floods.
(vi) Erruption of plant disease and pests.
(vii) Change in rainfall pattern.
Methods that can reduce the atmospheric concentration of greenhouses gases are
(i) Reducing the greenhouse gas emission by limiting the use of fossil fuels, and by developing alternative renewable sources of energy (wind energy, solar energy etc.)
(ii) Increasing the vegetation cover, mainly the forests, for photosynthetic utilization of CO₂.
(iii) Minimizing the use of nitrogen fertilizers in agriculture for reducing N₂O emissions.
(iv) Developing substitutes for chlorofluorocarbons.

4. Match the items given in column A and B:

Ans: (a)-(iii),(b)-(iv),(c)-(i),(d)-(ii)

5. Write critical notes on the following:
(a) Eutrophication
(b) Biological magnification
(c) Groundwater depletion and ways for its replenishment
Ans: (a) Eutrophication : It is excessive growth of algae, plants and animals in water bodies due to the nutrient enrichment particularly with nitrogen and phosphorus. It is both natural and accelerated. It leads to loss of bio-diversity and cuases chemical accumulation in food chain and ageing of water body.

(b) Biological magnification : Increase in concentration of persistent chemical at successive trophic levels is called eutrophication. This happens because a toxic substance accumulated by an organism can not be metabolized or excreted, and is thus passed onto next trophic level, e.g., DDT.

(c) Ground water depletion and replacement: Ground water depletion, a term often defined as long term water level declines caused by sustained ground water pumping, is a key issue associated with ground water use. Many areas of India experiencing ground water depletion.
The most servere consequence of excessive ground water pumping is that the water table, below which the ground is saturated – with water, can be lowered. If ground water level declines too far, then the well owner might have to deepen the well, drill a new well, or at least attempt to lower the pump.

6. Why ozone hole forms over Antarctica? How will enhanced ultraviolet radiation affect us?
Ans: Chlorofluorocarbons, mainly released in the atmosphere by developed countries, Slowly enters the stratosphere and the winds move them towards the poles. Environmental conditions prevailing in Antarctica during winter months; there is no sunlight in Antarctica and extremely low temperature ( – 85°C) facilitates the formation of ice clouds. During winter, natural circulation of wind (polar vertex) completely isolates Antarctic air from the rest of the world.

The ice clouds provide the catalytic surface for the reaction of chlorine atoms and then ozone. But this degradation of ozone occurs with the return of solar radiations to Antarctica during spring (September and October). This results in the thinning of ozone layer every year over most of Antarctica. This hole disappears in summer due to warming up of air and the mixing up of Antarctic air with that of the rest of the world.
Enhanced UV radiations on earth would affect humans and other animals by causing:

• Skin cancer
• Blindness and increased chances of cataract in eyes.
• Malfunctioning of immune system.
• Higher number of mutations.

7. Discuss the role of women and communities in protection and conservation of forests.
Ans: Amrita Bishnoi Wildlife protection project The Bishnoi community is known for its peaceful coexistence with nature. It was in 1730 AD. Amrita Devi protested against king’s men’s attemptto cut trees as it was prohibited in Bishnoi religion. It was a party of Maharaja Abhay Singhji, Rular of Marwar (Jodhpur) state who wanted to fell green khejdali trees. Amrita Devi fy her three daughter & more than 360 of other Bishnois lost their lives in saving trees & became martyers. Later ‘Chipko’ movement’ was started by Sunderlal Bahuguna and others to prevent cutting of trees. The people showed enormous bravery in protecting trees from the axe of contractors by hugging them.

8. What measures, as an individual, would you take to reduce environmental pollution?
Ans: To reduce environmental pollution we should take following measures:
(i) Reducing use of CFC.
(ii) Disposing off waste safely.
(iii) Reducing use of polythene.
(iv) Not disposing off waste in water bodies.
(v) Making automobiles pollution free.
(iv) Prevention of noise pollution by using fire crackers/TV/musical instruments at permissible limits.
(vii) Tree plantation in school, around residence.

9. Discuss briefly the following:
(a) Radioactive wastes
(b) Defunct ships and e-wastes
(c) Municipal solid wastes
Ans: (a) Radioactive waste : Radioactive waste include materials that are radioactive & for which there is no further practical use. These are generated by nuclear reactor, nuclear fallout, man made (refining and mining of platinum and thorium), natural radioactive waste and release of radiation in radiation therapy.
Increased risk of cancer, birth defects & infertility are few harmful effects caused by nuclear waste. So, nuclear waste is an extremely potent pollutant.

(b) Defunct ships & e-wastes – The dismantling of defunct ship is a technically complex process, which is potentially harmful to the environment & human health. Defunct i ships contain toxicants like asbestos, mercury, etc. The workers breaking the ships are not suitably protected and are exposed to toxic chemicals. The coastal areas in the vicinity of the ship-breaking yard also becomes polluted. At the international level, it is accepted that there is uncertainty about the relevant controls for the dismantling of such vessels & there is an urgent need to establish a specific enforceable control framework.
Electronic waste comprised of irrepairable computer and other electronic goods, generated by developed countries.
It is valuable source of secondary raw materials, if treated properly, however if not treated properly it is the major source of toxins. Eventually recycling is the only solution for the treatment of e-wastes provided it is carried out in an environment friendly manner.

(c) Municipal solid wastes : These are commonly known as trash or garbage. It consists of everyday items such as product packaging, furniture, clothing, bottles, food scraps, newspapers.
appliances, paints, batteries etc. Source reduction, recycling and compositing are several municipal social waste management practices. Source reduction involves altering the design, manufacture or use of products & materials to reduce die amount and toxicity of what gets thrown away. Recycling diverts items such as paper, glass, plastic & metals into anew products. Composting decomposes organic waste such as food scraps & yard trimmings with micro-organisms, producing a humus-like substance.

10. What initiatives were taken for reducing vehicular air pollution in Delhi? Has air quality improved in Delhi?
Ans: The initiatives were taken for reducing vehicular air pollution in Delhi are :-
(i) Introduction of CNG
(ii) Enforcement of pollution control law
(iii) Introduction of green zones
(iv) Use of unleaded fuels
(v) Replacement of old vehicle with new one. The result is that the air quality of Delhi has improved considerably with a substantial fall in pollutant gases.
(vi)Use of catalytic converters in vehicles.
(vii)Application of Euro II norms for vehicle.

11. Discuss briefly the following:
(a) Greenhouse gases
(b) Catalytic converter
(c) Ultraviolet B
Ans: (a) Greenhouse gases: Gases that trap the heat of the sun in the earth’s atmosphere increasing atmospheric temperature effect are called greenhouses gases. CO₂, CH₄, N₂O and CFC, cause greenhouse. In the absence of greenhouse gases, the temperature of earth would go down to -18°C. The net effect of higher GHGs will be disastrous, (i) Melting of polar ice caps and mountain snow caps resulting in rising of sea level threatening submergence of many islands and coastal areas. Odd climate changes like El Nino. Increased floods and drought.
(b) Catalytic converter : Catalytic converter ‘are used to reduce emission of poisonous gases like nitrogen oxides, carbon monoxide & un reacted hydrocarbon in automotive emission. It is made of platinum, palladium and rhodium and is used as catalyst. It converts unbumt hydrocarbons into CO₂. The only precaution required is not to use gasoline having lead as lead inactivates the catalysts of the converter.
(c) Ultraviolet B : Ultraviolet B is one of the three types of invisible light rays given off by the sun. Ultraviolet B penetrates the ozone layer in attenuated form & reaches earths. This is more over equator than poles due to thinning of ozone shield over equator. It causes skin cancer, reduce rate of photosynthesis in phytoplanktons, reduces diversity of aquatic ecosystem.

More Resources for CBSE Class 12:

​NCERT SolutionsMathsPhysicsChemistryBiologyScience​

NCERT Solutions For Class 12 Flamingo English A Thing of Beauty

​NCERT SolutionsMathsPhysicsChemistryBiologyScience​

IMPORTANT STANZAS FOR COMPREHENSION

Read the stanzas given below and answer the questions that follow each:
1.A thing of beauty is a joy forever Its loveliness increases, it will never Pass into nothingness; but will keep A bower quiet for us, and a sleep
Full of sweet dreams, and health, and quiet breathing.
Questions
(a)Name the poem and the poet of these lines.
(b)How is a thing of beauty a joy for ever ?
(c)What do you understand by a ‘bower’l
(d)What kind of sleep does it provide?
Answers:
(а)The poem is A Thing of Beauty. The poet is John Keats.
(b)A thing of beauty is the source of constant joy. Its beauty goes on increasing. It will never pass into nothingness.
(c)A bower is a pleasant place in the shade under a tree. It protects persons/animals from the hot rays of the sun.
(d)It provides us a sound sleep, full of sweet dreams, health and peaceful breathing.

2. Therefore, on every morrow, are we wreathing A flowery band to bind us to the earth,
Spite of despondence, of the inhuman dearth Of noble natures, of the gloomy days,
Of all the unhealthy and o’er-darkened ways
Made for our searching: yes, in spite of all,
Questions [All India 2014]
(a)Name the poem and the poet.
(b)Why are we despondent?
(c)What removes the pall from our dark spirits?
(d) What are we doing every day?
Answers:
(а)The poet is John Keats. The poem is A Thing of Beauty.
(b)We possess the evil qualities of malice and disappointment. We suffer from the lack of noble qualities. That is why we feel despondent.
(c) Some beautiful shapes or a thing of beauty removes the pall of sadness from our hearts or spirits.
(d) We are weaving a flowery wreath to bind us to the beauties of the earth.

3. Some shape of beauty moves away the pall From our dark spirits. Such the sun, the moon,
Trees old, and young, sprouting a shady boon For simple sheep; and such are daffodils
With the green world they live in; and clear rills That for themselves a cooling covert make ‘Gainst the hot season; the mid forest brake,
Rich with a sprinkling of fair musk-rose blooms;
Questions
(а)What removes the pall from our dark spirits?
(b)What sprouts a shady boon for sheep and how?
(c) How do ‘daffodils’ and ‘rills’ enrich the environment?
(d) What makes the mid-forest brake rich?
Answers:
(a)Some beautiful shape or a thing of beauty removes the pall of sadness from our hearts or spirits.
(b)Old and young trees sprout to make a green covering. It proves a blessing for simple sheep as it serves them as a shelter.
(c)Daffodils bloom among the green surroundings. The rills or small streams of clear water make a cooling shelter for themselves against the hot season.
(d)The mid forest brake is made rich by the blooming of beautiful musk-roses.
(e)(i) pall, (ii) boon, (Hi) rills, (iv) covert.

4. And such too is the grandeur of the dooms
We have imagined for the mighty dead;
Ml lovely tales that we have heard or read;
An endless fountain of immortal drink,
Pouring unto us from the heaven’s brink
Questions [Delhi 2014]
(a)Name the poem and the poet of these lines.
(b)Explain: ‘the grandeur of the dooms’.
(c)What is the thing of beauty mentioned in these lines’?
(d)What image does the poet use in these lines?
Answers:
(а)The poem is A Thing of Beauty. The poet is John Keats.
(b)The magnificence that we imagine for our mighty dead forefathers on the dooms day.
(c)The lovely tales of mighty men are mentioned in these lines.
(d)The poet uses the image of ‘an endless fountain of immortal drink’ to describe the beautiful bounty of the earth. The earth has bestowed us with sun, moon, flowers, rivers, greenery etc.

QUESTIONS FROM TEXTBOOK SOLVED

Q1. List the things of beauty mentioned in the poem.
Ans: Everything of nature is a thing of beauty and a source of pleasure. Some of them are: the sun, the moon, old and young trees, daffodil flowers, small streams with clear water, mass of ferns and the blooming musk-roses. All of them are things of beauty. They are a constant source of joy and pleasure.

Q2. List the things that cause suffering and pain.
Ans: There are many things that cause us suffering and pain. Malice and disappointment are “the biggest source of our suffering. Another one is the lack of noble qualities. Our unhealthy and evil ways also give birth to so many troubles and sufferings. They dampen our spirits. They act as a pall of sadness on our lives.

Q3. What does the line, ‘Therefore are we wreathing a flowery band to bind us to earth’ suggest to you?
Ans: Keats is a lover of beauty. He employs his senses to discover beauty. The link of man with nature is eternal. The things of beauty are like wreaths of beautiful flowers. We seem to weave a flowery band everyday. It keeps us attached to the beauties of this earth.

Q4. What makes human beings love life in spite of troubles and sufferings?
Ans: There are many things that bring us troubles and sufferings. They dampen our spirits. However, ‘some shape of beauty1 brings love and happiness in our lives in spite of such unpleasant things. A thing of beauty removes the pall of sadness and sufferings. It makes us love life.

Q5. Why is ‘grandeur’ associated with the ‘mighty dead’?
Ans: The mighty dead were very powerful and dominating persons during their own times. Their achievements made them ‘mighty’ and great. Their noble works dazzle our eyes. We imagine that such mighty dead forefathers will attain more grandeur on the doomsday. Hence ‘grandeur’ is associated with the ‘mighty dead’.

Q6. Do we experience things of beauty only for short moments or do they make a lasting impression on us?
Ans: We feel happy by coming into contact with things of beauty. They make a lasting impression on us. Keats makes it clear at the outset. A thing of beauty is a joy forever. It is a constant source of joy and pleasure. Its beauty never declines or diminishes. Its loveliness goes on increasing every moment. Its value remains undiminished. It never passes into nothingness. It removes the pall of sadness that covers our dark spirits.

Q7, What image does the poet use to describe the beautiful bounty of the earth?
Ans: John Keats uses a very beautiful image to describe the beautiful bounty of the earth. It is the endless fountain of immortal drink. It pours constantly into our hearts from heaven. Thus, the beautiful bounty of the earth is called “an endless fountain of immortal drink.”

MORE QUESTIONS SOLVED

SHORT ANSWER TYPE QUESTIONS (Word Limit: 30-40 words)
Q1. How is a thing of beauty a joy forever?
Ans: According to John Keats a thing of beauty is a joy of forever. It is a constant source of happiness and pleasure. Its loveliness increases every moment. It will never pass into nothingness. In other words, a thing of beauty is never devalued.

Q2. How does a thing of beauts provide us shelter and comfort?
Ans: John Keats is a great Romantic poet. He is rich in sensuous imagery. Nature provides us things of rare beauty. It keeps a bower quiet for us. A bower is a pleasant place in the shade under a tree. A thing of beauty also provides us peace and security. We enjoy a sound sleep which is full of sweet dreams, health and peaceful breathing.

Q3. How do us bind our self to the earth every morning?
Ans: All the Romantic poets stress upon the relationship between man and nature. Keats believes that there is an unbreakable bond which binds man with nature and the earth. The beauties of the earth fascinate man. Every object of nature is a source of beauty and happiness. Everyday we are weaving a wreath of flowers. This flowery band binds us to the beauties of this earth.

Q4. What are the things that cause miseries, sorrows and sufferings to man ?
Ans: Man himself is the root cause of all his sufferings. We suffer from malice and distress because we lack human qualities that makes us inhuman. Our life becomes gloomy. We cultivate unhealthy and evil ways. All such things bring miseries, sorrows and sufferings to man.

Q5. What spreads the pall of despondence over our dark spirits? How is it removed?
Ans: Man is the creator of his woes. His own nature and actions make his life miserable. He faces miseries and pains. A pall of despondence covers his dark spirits. A thing of beauty provides a ray of hope to man. Some shape of beauty works wonders amid these sorrows and sufferings. It is a thing of beauty that removes the pall of despondence over our dark spirits.

Q6. Name the beauties of nature that are constant source of joy and happiness to man.
Ans: Nature is a store house of beauty. The beauties of nature are endless. The sun, the moon, old and young trees, beautiful daffodil flowers and green surroundings are some of such beautiful things. Small streams with clear water, thick mass of ferns, thickets of forest and musk-rose are some other things of beauty. All such things of beauty are a constant source of joy and happiness to man.

Q7. Why and how is ‘grandeur associated with the ‘mighty dead’?
Ans: The dooms day is considered the day of judgement, when the dead will receive what is due to them. Our mighty dead forefathers earned name and fame with their noble deeds. It is hoped that they will be rewarded with rare magnificence and grandeur.

Q8. How is a thing of beauty lovelier than all the lovely tales we have heard and read?
Ans: All beautiful things of nature are a boon for humanity. The magnificence and beauty of objects of nature surpasses the grandeur of dooms that we have imagined for our mighty dead forefathers. It is lovelier than all the lovely tales that we have heard or read.

Q9. What is the source of the ‘endless fountain’ and what is its effect?
Ans: A fountain of eternal joy’and immortality pours into the heart and soul of man. It flows right from the heavens brink and pours into the human heart. It is like an immortal nectar. The immortal drink that nature’s endless fountain pours into our hearts is a source of immense joy for us.

Q10. What is the message for the theme) of the poem ‘A Thing of Beauty’?
Ans: The very first line contains the message that John Keats, the great Romantic poet, wants to convey. Keats was a worshipper of beauty. For him beauty was truth and truth, beauty. Hence, for him a thing of beauty is a joy forever. Beauty never fades. Nor is it ever devalued. It never passes into nothingness. When we are full of sorrows and sufferings, some form of beauty comes to our rescue. It removes the pall of sadness and sorrows and gives us joy and pleasure. Thus, beauty is a boon for human beings.
More Resources for CBSE Class 12
RD Sharma class 12 Solutions
NCERT Solutions for Class 12th English Flamingo
NCERT Solutions for Class 12th English Vistas
CBSE Class 12 Accountancy
NCERT Solutions for Class 12th Maths
CBSE Class 12 Biology
CBSE Class 12 Physics
CBSE Class 12 Chemistry
CBSE Sample Papers For Class 12

NCERT Solutions Class 12 Flamingo EnglishClass 12 Vistas English

NCERT Solutions For Class 12 Flamingo English Keeping Quiet

​NCERT SolutionsMathsPhysicsChemistryBiologyScience​

IMPORTANT STANZAS FOR COMPREHENSION

Read the stanzas given below and answer the questions that follow each:
1.Now we will count to twelve and we will all keep still.
Questions
(a)Name the poem and the poet of these lines.
(b)Why does the poet ask us to count to twelve?
(c)Why does the poet ask us to keep still?
(d) Find words from the passage which mean.
(ii) say number (iii) quiet and motionless.
Answers:
(a)The name of the poem is Keeping Quiet. The name of the poet is Pablo Neruda.
(b)There are only twelve signs on the clock to measure hours. Therefore, the poet asks us to count till the clock measures these horns.
(c)Too much activity and rush has only brought misfortunes to mankind. Hence, it is better to be quiet and still.
(d) (i) count (ii) still

2. For once on the face of the Earth let’s not speak in any language, let’s stop for one second,
and not move our arms so much.
Questions
(a)Name the poem and the poet of these lines.
(b)‘Let’s not speak in any language’, says the poet. Why?
(c)What should we not do for a second?
(d) What do you understand by ‘the face of the Earth ?
Answers:
(a)The name of the poem is Keeping Quiet. The poet is Pablo Neruda.
(b)The people of the world have been indulging in wars and bloodsheds on minor excuses. If they keep quiet, they may not indulge in reasoning, disputes and quarrels. So, let them keep quiet and not speak in any language. This will ensure peace and prosperity.
(c)We should cease all activities for a second. Man has used his arms only to kill and destroy others. Therefore, let them not move their arms so much as to harm others.
(d) The expression “the face of the Earth’ refers to the various countries on the surface of the earth.

3.It would be an exotic moment without rush, without engines, we would all be together
in a sudden strangeness.
Questions
(a)Name the poem and the poet of these lines.
(b)What will happen if there is no rush or running of engines?
(c)What sort of moment will it be?
(d)How would all of us feel at that moment?
Answers:
(a)The name of the poem is Keeping Quiet. The poet is Pablo Neruda.
(b)There will be peace all around if there is no rush or the sound of the running of engines and machines.
(c)It will be a very enticing and beautiful moment.
(d) All of us will enjoy the unusualness and sudden strangeness of that moment.

4. Fishermen in the cold sea would not harm whales and the man gathering salt
would look at his hurt hands.
Questions
(a)What do fishermen usually do in the cold sea?
(b)What does the poet ask fishermen not to do?
(c)What has happened to the man gathering salt?
(d) What should the man gathering salt do?
Answers:
(a)Fishermen usually catch fish, particularly whales, in the cold seas.
(b)The poet asks fishermen not to hurt or injure the whales in the seas.
(c)The man gathering salt has injured his hands.
(d)He must take care of his hurt hands.

5. Those who prepare green wars,
wars with gas, wars with fire,
victory with no survivors,
would put on clean clothes
and walk about with their
brothers
in the shade, doing nothing.
Questions
(a)Name the poem and the poet of these lines.
(b)What sort of wars are mentioned in the above lines?
(c)What kind of victory will it be?
(d) How should the lovers of war behave?
Answers:
(а)The name of the poem is Keeping Quiet. The poet is Pablo Neruda.
(b)Green wars, wars with poisonous gases and wars with the fire are the different kinds of wars.
(c) It will be a victory where no survivors will be left to celebrate it. Such a victory will be meaningless.
(d) They should put on clean clothes and walk with their brothers under the trees leisurely doing nothing.

6.What I want should not be confused
with total inactivity. i Life is what it is about;
I want no truck with death.
If we were not so single-minded
about keeping our lives moving,
and for once could do nothing,
perhaps a huge silence
might interrupt this sadness of never understanding ourselves and of threatening ourselves with
death.
Questions
(a)What does the poet want? What should it not be confused with?
(b)Explain: 7 want no truck with death’.
(c)What do people pursue single-mindedly? Which is the better course the poet suggests?
(d)When can a huge silence do us good?
Answers:
(а)The poet is advocating for silence or stillness. Stillness should not be confused with total inactivity.
(b)Total inactivity brings death. The poet refuses to associate (or deal) with death. Thus, he is not advocating for death.
(c)People pursue single-mindedly on keeping their lives moving. ..The poet suggests that it would be better if they give themselves rest for sometime. For once they may do nothing.
(d)A huge silence can do us a lot of good when we are disappointed at not understanding ourselves or threatening ourselves with death.

7. Perhaps the Earth can teach us as when everything seems dead and later proves to be alive.
Now I’ll count up to twelve
and you keep quiet and I will go.
Questions
(a)What can the Earth teach us?
(b)What remains alive when everything seems dead?
(c)Who is the poet? What does he want to do?
(d)What does the poet ask us to do?
Answers:
‘(a) The earth can teach us a lesson how to live on it.
(b)Only the earth remains alive when everything seems dead.
(c) The poet is Pablo Neruda. He wants to count upto twelve.
(d) He asks us to keep quiet while he is counting upto twelve.

QUESTIONS FROM TEXTBOOK SOLVED

Q1. What will counting up to twelve and keeping still help us achieve?
Ans: Counting up to twelve takes very short time. Keeping still for this brief interval of time gives us a momentary pause to introspect and review the course of action. It is generally observed that most of the ills and troubles of the world are caused by our rush or hurry. Violence is caused by anger. Keeping quiet and still will give us necessary respite and ensure peace.

Q2. Do you think the poet advocates total inactivity and death?
Ans: No, he doesn’t advocate either total inactivity or death. He makes it quite clear that ‘stillness’ should not be confused with “total inactivity or equated to it. Total inactivity brings death. But Neruda has ‘no truck with death’. His stillness means halting of harmful and hostile human activities.

Q3. What is the ‘sadness’ that the poet refers to in the poem? [All India 2014]
Ans: Man’s sadness is formed out of his own actions and thoughts. It is quite ironical that man who understands so much fails to understand himself and his action. Rash actions prove harmful and disastruous. Man is the creator of all disasters. He is always threatening himself with death because of his thoughts and actions. This is the tragedy of his life.

Q4. What symbol from Nature does the poet invoke to say that there can be life under apparent stillness?
Ans: The poet wants to prove that there can be life under apparent stillness. The poet invokes the earth as a living symbol to prove his point. The earth never attains total inactivity. Nature remains at work all the time even under apparent stillness. It keeps earth alive. This idea is beautifully illustrated by the following lines:“as when everything seems dead and later proves to he alive.”

Q5. Choose a quiet corner and keep still physically and mentally for about five minutes. Do you feel any change in your state of mind?
Ans: Extension Activity: For self-study.

MORE QUESTIONS SOLVED

SHORT ANSWER TYPE QUESTIONS (Word Limit: 30-40 words)
Q1. Why does Pablo Neruda urge us to keep still?
Ans: Stillness is essential for calm reflection and quiet introspection. We hear the voice of conscience in moments of silence. The poet is convinced that most of human ills and miseries are caused by man’s hurry and rush to do things. The poet wishes that we may withdraw ourselves from our undesirable actions and keep still for a moment.

Q2. Why shouldn’t we “speak in any language” and “not move our arms so much”?
Ans: People of the world speak in different languages. They indulge in unnecessary debates and disputes. Most of these arguments lead to destructive wars. The poet urges people to stop speaking in any language. They must speak through their hearts. So far men have moved their arms only to harm others. Therefore, the poet wants that they should not move their arms so much. Let these arms rest for once. Let a feeling of mutual understanding , be created among human beings.

Q3. Pablo Neruda says:“we would all be together in a sudden strangeness.”
When can we experience such a moment? Why will that be an exotic moment?
Ans: Non-stop activity, unnecessary rush and noise have made our lives unpleasant and full of misery, pain and troubles. We must stop rushing, hurrying, worrying and running. Even the noise of engines and machines must stop for once. Then all of us will enjoy the sudden strangeness of that moment. It will be a unique moment. In that exotic or fascinating moment we shall feel totally relaxed, physically as well as mentally.

Q4. What does the poet ask the fisherman and the man collecting salt to dot What docs In-exactly want to convey by this?
Ans: Pablo Neruda is against any kind of violence. He addresses the fishermen and asks them not to harm whales living in the cold seas of the polar regions. He is also against any kind of self torturing. The man who is gathering salt has hint his hands. He asks this man to look after himself and take care of his injured hands.

Q5. What are the different kinds of war mentioned towards war?
Ans: The poet is against wars of all kinds. He wants a total stoppage of war. Green wars against the environment, wars with poisonous gases and wars with fire must be terminated (stopped) at once.

Q6. What alternative does Pablo Neruda suggest instead of indulging in wars?
Ans: Instead of indulging in wars, the people must come out in their best dresses with then- brothers. They should go out for a walk under the shady trees and enjoy themselves doing nothing. This would bring the feeling of togetherness among them.

Q7. How does the poet distinguish ‘stillness’ from ‘total inactivity’? Why does Neruda saw I want no truck with death?
Ans: Pablo Neruda is in favour of stillness or silence. We remain still and quiet for sometime. On the other hand, total inactivity is a permanent suspension of work. It is just like death. ‘Stillness’ should not be Confused with ‘total inactivity’. Life goes on as usual. There can’t be anything like total inactivity. The poet refuses to associate with death or deal with it.

Q8. Why does the poet fee! that we should not be so single-minded’?
Ans: People are generally single-minded. They want to focus on only one thing. They want to keep their lives going. They are ever busy in their pursuit. The poet wishes that they would not be so much absorbed with always remaining on the move. They must have some respite or rest. They too need peace or silence.

Q9.Why do men become sad? How can this sadness be overcome?
Ans: Men fail to understand themselves. They are always threatening themselves with death. When they realise their failure to understand themselves they become sad or helpless. Fear of death also makes them sad. Only a huge silence’ can interrupt this sadness. Such silence will do them good.

Q10. How might a huge silence interrupt the sadness of men?
Ans: Men never understand themselves. Nor are they ever sure of their actions. They face another tragedy. Due to their own actions, they are threatening themselves with death. This realisation makes them helpless and sad. Only a huge (long) silence might interrupt this sadness and do them some good.

Q11. Under the apparent stillness there is life. Justify this statement giving an example from the poem ‘Keeping Quiet’.
Ans: Neruda does not equate stillness with total inactivity. He believes that under this apparent stillness there is life. We can learn it from the earth. When everything seems dead, the earth still remains alive. The earth is never dead. The life on the earth goes on as usual under the apparent stillness.

Q12. Justify the title ‘Keeping Quiet’.
Ans: The title of the poem is quite appropriate and logical. It suggests the necessity of quiet introspection. The people of the world are overactive and always on the move. Their activities have caused untold troubles and sufferings. Keeping quiet will do them a lot of good. It will save them from many harmful and violent activities. Moreover, it will help in reflecting over the fate of man and help in creating a feeling of mutual understanding among human beings.

Q13. Which is the exotic moment that the poet refers to in ‘Keeping Quiet’:[Delhi 201]
Ans: The poet talks about the exotic moment when everyone keeps quiet. There will be no rush for a second. The machines must stop for a moment. That moment will be fascinating for all of us. All of us shall enjoy the sudden strangeness of the moment together.

More Resources for CBSE Class 12
RD Sharma class 12 Solutions
NCERT Solutions for Class 12th English Flamingo
NCERT Solutions for Class 12th English Vistas
CBSE Class 12 Accountancy
NCERT Solutions for Class 12th Maths
CBSE Class 12 Biology
CBSE Class 12 Physics
CBSE Class 12 Chemistry
CBSE Sample Papers For Class 12

NCERT Solutions Class 12 Flamingo EnglishClass 12 Vistas English